Saturday, August 31, 2019
Public Speaking Self Reflection Essay
The information in this paper will include the topics of a presentation such as the introduction, body, conclusion, delivery, language, audience and topic, visual aids, and the general evaluation. This paper embraces the thoughts from the presenter, incorporating personal ideas and those of peers and instructors, on how this speech went during each step of the giving process. By reviewing the presentation and accumulating the thoughts of those involved will improve future productions. Introduction The intro to this presentation should catch the attention of any doctor who knows about time management. Gaining attention and interest early was a goal in this presentation. The topic to save time and view radiology films from home was clear, and informative. An overview was not given of what would be covered instead the speech flowed into the step by step to view the images from home . Body The body of this presentation logically flowed step by step, using PowerPoint to deliver messages clearly and so that the audience could follow along more easily. No misinterpretation was felt regarding the use of language spoken, and the body was delivered well. The steps were clear and concise. Delivery When viewing the presentation again, it was rushed from start to finish. The time factor disabled the use of more information being shared. A well defined topic would have solved this problem. Watch out for eye contact, hand gestures, and bouncing around, these were noticed and portrayed poor body language. There were not any pauses due to time constraint. There were times that there could have been a pause to prove a point, or to allow the audience to ask a question or catch up to the speaker. Language The language used was appropriate. Due to the recording device used the audience could not hear clearly. Future presentation must have a better sound system. Audience and Topic The message was adapted for the appropriate audience. One of the biggest topics in any clinic is how to save time in a day. This is one suggestion for doing just that. Any doctor looking to save time would view this two minute presentation to allow them a few extra minutes each day. Visual Aids Step by step instructions were used via PowerPoint, on how to view Patient Images from home. The slides allowed the audience to view the steps clearly and efficiently. Many times in this presentation the visual aids allowed the speaker a chance to look away from the audience. A quick glance is fine but there is no reason to read the slide. Conclusion The end of the presentation was as rushed as the beginning and body. The reinforcement of how this would save time in the day, allowing more time with patients, was preparation to the end of the speech. There was not a vivid ending just more of the same Power Point presentation. A stronger conclusion would have helped close the presentation with confidence. Overall Evaluation The presentation was good throughout. There could have been a better sound system to make the presentation more appealing. The requirement was met for the assignment. To respect attention to detail, the time limit was followed closely. A general comment stated, was to wait a second or two prior to speaking to allow equipment to work so as not to cut off the beginning. There was clear purpose and overall the outcome was quite good. By reviewing the important parts of a presentation, introduction, body, conclusion, delivery, language, audience and topic, visual aids, and overall evaluation, the giver of the speech can use the information provided to improve upon them self. Overcoming the need to think of oneself as right and allowing outside perspective enables the speech presenter the ability to become a remarkable speaker, in everyoneââ¬â¢s eyes.
Friday, August 30, 2019
Existing Direct Tax System and Proposed Direct Tax Code in India Essay
Tax is defined as a compulsory payment made to the government by the individuals firms and companies without any expectation of a direct return. In general there are two types of tax system prevailing in our country. One is direct tax and other is indirect tax. Here we will restrict our discussion to direct tax only. Direct taxes are those the burden of which cannot be shifted, that is incidence and impact is on the same person. In India the tax law is governed by the finance act. The amendments are brought through budget every year which is issued on the last date of February. There have been various arguments in regard to the complexity of the tax laws. The new tax system which is proposed basically focuses on the principle of equality and simplicity. Instead of having different explanations of tax laws under different umbrellas all the laws will be brought under one head. The new tax system will be highly focused on the matter that the richer should pay heavier tax and vice-versa. For this regard the exemption limit and tax slabs will be expanded higher. Moreover under new taxation laws various taxes like securities transaction tax will also be abolished thus making the code an efficient one. With the new tax code being implemented in India one can expect to have free trade across the length and breadth of the country and peace in the bags of investors. Thus, the new tax system is an attempt to create a system with minimum loopholes of the existing system, thus contributing to the national benefit.
Thursday, August 29, 2019
Cookie Cutter Shark Facts
Cookie cutter shark ââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬â- Features: The Cookiecutter Shark combines many specialized features that enable it to carve out a living in the deep-sea. Like many mesopelagic sharks, it has an elongated body cavity filled with an enormous liver comprising as much as 35% of its total weight. The Cookiecutterââ¬â¢s liver is perfused with low-density oils which render the shark nearly neutrally buoyant over a wide range of depths and thereby saves energy by freeing it from the need to swim constantly to avoid sinking.It has very large eyes ââ¬â the better with which to see potential prey ââ¬â and a short, broad caudal fin that is ideal for rapid bursts of acceleration over short distances ââ¬â that is, ambushing prey from close range. ââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬ââ â¬â- Hunting abilities: To lure prey within range, the Cookiecutter Shark relies on its brilliant luminescence. Complex light-producing organs called ââ¬Å"photophoresâ⬠are scattered over the Cookiecutterââ¬â¢s entire body and are especially richly distributed on its belly and lower surfaces.A main function of this pattern of bioluminescent organs is to eliminate an animalââ¬â¢s shadow as seen from below, a common mesopelagic anti-predatory strategy known as ââ¬Å"counter-illuminationâ⬠. But there is a very curious fact about the distribution of photophores on the Cookiecutter Sharkââ¬â¢s undersurfaces: they are completely absent from the region under the throat between the gill slits. It has recently been proposed that this dark patch that is bordered by luminescent organs may mimic the search image of many upward-looking pelagic predators.Thus, when a would-be predator approaches what appear to be a small shadow of a potential prey animal, it is brought wi thin the striking range of the insidious Cookiecutter Shark and the predator has become prey. ââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬â- Humans who, by accident or by design, enter the open sea are not immune from attacks by Cookiecutter Sharks. The body of a drowned fisherman recovered ff the coast of Oahu, Hawaii, in July 1992 had two Cookiecutter bites to the lower back. These bites are believed to have been inflicted post mortem, but there are a few documented reports of people ââ¬â including shipwreck survivors and, in one case, an underwater photographer ââ¬â being attacked in the tropical open ocean by schools of blunt-snouted and extremely ferocious foot-long (30-centimetre long) ââ¬Å"fishâ⬠that neatly sliced out circular plugs of flesh about an inch (2. centimetres) in diameter. The fish responsible may well have been Cookiecutters. This frightening possibility certainly p uts the romantic notion of a moonlight swim in a whole new light. ââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬â- ââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬âââ¬â]
Wednesday, August 28, 2019
Understanding Management accounting and Financial Management Dissertation - 1
Understanding Management accounting and Financial Management - Dissertation Example Understanding Management accounting and Financial Management In the modern business environment, budgeting provides a feasibility analysis of the present and future needs of the capital needs and resources. The usefulness of budgeting as a management control tool is very significant. Preparing budgets is the financial basis for modern business environments as it enables organizations to establish milestones, determine the internal and external potential of the business to the managers and the investors respectively. Many companies find it difficult to prepare budgets but its importance cannot be overlooked. Budgeting can provide benchmarks for the organizations and managers as how to conduct and control the operating activities so as to meet the required target provided by the budgets. Later on, the budgets can be compared with the actual results which can provide an analysis where improvements need to be made and which area needs more controlling. Since organizations can prepare many types of budgets such as sales budget, production cost budget, expense budget and so on, cash budget remains the backbone of the other budgets. The process of budgeting can facilitate the integration of goals of employees, teams and organization as a whole. If the budget is thought about as a control system, then in context with the modern business environment, it is necessary that all levels of organization participate in the process of budgeting so that when actual results are acquired, it can be compared against the budgets and measures of improvement can be suggested. (Davidson, 2009). In case of South-guys Partnership Ltd there are many ways in which the cash budget can facilitate management of control. Since the cash budget enables to plan to the usage of cash efficiently, it shows where the company has cash surplus in a given a time period and where it has deficiency thus enabling the management to make arrangements before the deficiency actually occurs or in other case, make plans for investing the surplus cash in other profitable ventures (Shim and Siegel, 2008). This is main advantage of cash budget that South-guys Partnership Ltd can use to create a better and efficient cash flow for their organization. Thus budgeting has the capability to provide forecast for the future needs of cash or funds before the organization can actually face the crisis. It allows for planning and raising of funds at reasonable costs and terms from many different sources (Rickards, 2006). In addition to this, modern business environment requires businesses to maintain liquidity the basis of which is cash requiring companies to maintain a minimum margin of cash according to
Tuesday, August 27, 2019
Measuring Performance Essay Example | Topics and Well Written Essays - 1000 words
Measuring Performance - Essay Example And, gross margin in 2011 was (26,978,000 / 57,400,000) = 0.47. (a) (ii) If, gross margin of a firm is higher in one year compared to previous year, then it can be said that the company has shown higher efficiency in converting its raw materials into revenues in that year compared to the last year. Thus, companies always want to make higher gross margin. But, it has been found that for Maldives Plc gross margin has declined from 2010 to 2011. It indicates that the company has been less efficient in converting its raw materials into revenues in 2011 compared to 2010. Thus, the performance of Maldives Plc has deteriorated in 2011 from 2010. Hence it can be said that, financial health of Maldives Plc was better in 2010 than in 2011. (Zairi, 1994) (b) (i) Issuing ordinary shares is a method of financing a companyââ¬â¢s productive activities. Total number of ordinary shares that the Maldives Plc had in issue in 2010 was (14,300,000/ 2.86) = 5,000,000. Total number of ordinary shares th at the Maldives Plc had in issue in 2011 was (16,320,000/ 2.72) = 6,000,000. (b) (ii) A company finances its productive activities either through equity or trough debt. Equity financing implies issuing ordinary shares to public. On the other hand, debt financing implies taking loans from various organizations or individuals. Increasing in the volume of debt is not good for a companyââ¬â¢s financial health as debt is huge liability for a company. (Spitzer, 2007) It is found that the number of ordinary shares issued by Maldives Plc has increased in 2011 from 2010. It implies that the company has put more stress on equity financing in 2011 than in 2011. However, in order to get clearer picture about the financing activities of Maldives, it is necessary to have information on long term and short term debt financing of Maldives Plc in 2011 and 2010. Although, it is not still clear from the number of ordinary shares in 2010 and 2011 whether the burden of debt has increased or decreased . The increase in the number of ordinary shares in 2011 will be a good indictor for the financial health of the company if it is coupled with decreased in debt financing. Hence, I would like to have more information on long term and short term debt of Maldives Plc in 2010 and 2011. (Spitzer, 2007) (c) (i) Price earning ratio of a company is generally measured by dividing the market price a stock in a particular year by earnings per share in that year. Here, the market prices of ordinary share issued by Maldives Plc in 2010 and 2011 had been ? 42.90 and ? 38.08 respectively. Now, earnings per ordinary share had been ? 2.86 and ? 2.72. Thus, price-earning ratio for 2010 was (42.90/2.86) = 15. And, price-earning ratio for 2011 was (38.08/2.72) = 14. (c) (ii) The price earning ratio for a stock in reality reflects the association between the market price of the ordinary shares issued by the company and the earnings per share issued by the company in a particular period. This ratio is ex tensively used determine profitability of a company. The market uses the information on profitability of a company to determine the price of the stock issued by that company. If profitability shows an increasing trend, then market also responds by increasing price per ordinary share. But, a downward trend in profitability acts as a bad signal regarding the performance of the company to the market. The market generally responds to a decline in profitability by
The System of Care for Individuals With a Stroke Research Paper
The System of Care for Individuals With a Stroke - Research Paper Example The research design selected by the researchers is appropriate to answer the research question because they collected first-hand information from the patients when they visit the clinic; hence, not relying on the distorted information.The target population has been specified to include 213 patients from different races and walks of life or people who have different social, cultural and economic background. The eligibility criteria have not been clearly stipulated, but the study indicates that the sample taken is representative of the people who visit the clinic and is suffering from a stroke (Moorley et al. 2014). The type of sampling type that was used in the study was absence/presence sampling plan. The key attributes of the sample are that all the patients suffer from stroke. Secondly, the patients use the similar hospital for treatments.The data in this research was gathered using a survey research where a study of 213 people was conducted on their recovery process of stroke, esp ecially depending on different races (Torbey & Selim, 2013).The authors concluded that Demographic profiling indicated the prevalence of stroke. Additionally, the researchers recommended that attendance figures reflected that people who are at-risk are those in the inner city and the findings from the research can be applied to the similar inner-city populations. The authorââ¬â¢s implication for the practice is that people who suffer from stroke do not get the nursing care they deserve because people lack the understanding of the effects of the disease on the individuals social and psychological effects.3. In case a program was introduced to help patients suffering from stroke would the families accept to take their sick family members to such institution without feeling as if they were being neglected?
Monday, August 26, 2019
Common Assessment Term Paper Example | Topics and Well Written Essays - 1000 words
Common Assessment - Term Paper Example The Financial crisis has severely affected the personnel of the organizations. There have been several instances of employeesââ¬â¢ retrenchment, downsizing as well as cutting the workforce to reduce the fixed overheads. This has resulted in the organizations left with only a fewer employees to meet the obligations and this causes the organizations to suffer not only in producing more products but also in producing quality products. (Skipper, 2009, pp.3-5; Basu, n.d, pp.205-207; Shah, 2010) The paper will assess the situation where the executives have been trying to redesign the jobs for employees and thereby facing a loss of employees every time they attempt to change the structure. Boosting Employee moral: An organization should look at effectively protecting the morale of the employee and constantly monitor the employee morale because the organizations have to realize at first the growth, the productivity of the organization rest mainly on the employeesââ¬â¢ expertise. So the organization must be clear and lucid to the point of the scope of each and every employee. Giving a clear and transparent job specification to each and every employee is highly essential. Proper and effective communication is also highly important as clear communication addresses many complex issues. The employee should be given enough space for expressing ideas in a particular matter the employee is expert. The employee should be given in hand training for the particular job and should be given adequate feedback for their improvement such that the employee can get accustomed to the job requirement as needed by the employer. (Bruce, 2002, pp.69-74; Martocchio, 2004, pp.163-164) Designing crisis management: During the times of recession, the executives have been involved in restructuring the jobs, the situation during the crisis have gone to such extent that the employees working in a particular domain had to work on other domains simultaneously. There have been several instances wh en an employee working in a higher designation has to work for much lower designation profiles which have acted to a huge impediment to the morale up gradation of the employee. During the crisis period the situation has gone to such a level that in an IT organizations employees working as software developers for the organization even had to do marketing jobs which is a completely different profile for those employees. Moreover, employees working in higher designations to the level of floor managers or middle level managers in an organizational structure had to do works like depositing funds or withdrawal of funds from banks which are simply clerical jobs. So in different high esteemed organizations employees of higher repute and working in much senior positions had to do simple clerical jobs mainly to make up for the jobs of the employees who have been retrenched during the crisis. This has caused a huge moral degradation of the employees. On the other hand this has severely increas ed the work load on the employees as they had to take multidimensional roles in their work. This has caused a major setback in the employeesââ¬â¢ moral. This has again resulted in employees resigning their positions as not
Sunday, August 25, 2019
Trends in team building activities Coursework Example | Topics and Well Written Essays - 750 words
Trends in team building activities - Coursework Example In her article, team building is the way to go for any business. For any manager to be considered successful in their leadership roles; they must ensure they have sound, active and well-balanced teams working harmoniously towards achieving the organizationââ¬â¢s long-term goals. Look at all successful business institutions, you will discover that the reason behind their fortunes is the composition of thelabor force that is relating well, with each other. Nothing positive can be achieved unless there is a good collaboration among people employed in an organization. She further says that, before any management directs its efforts towards moving the organization to the next level of success, it should ensure it makes team building its first priority. The author either gives examples of the classic Hawthorne Studies of between 1927 1nd 1932, where it was discovered that a groupââ¬â¢s results are better compared to the totals of individuals working independently or in 1993, Elton Ma yo seconded this when he found out that a group was essential because of three unique characteristics it owned. They include a feeling of social support, a sense of group identity and cohesion. These characteristics are a strong motivation towards a group or team achieving its goals. The author goes ahead to support her findings of the importance by comparing two generations. That of 1960s that gave little attention to teamwork since most reward systemswasbased on individual performances and that of 1980s, which advocated for teamwork.
Saturday, August 24, 2019
Strategic Decision making creates global competitive advantage for Research Paper - 1
Strategic Decision making creates global competitive advantage for South African Breweries - Research Paper Example The firm strongly emphasizes on the continuous development of its strategies, through strategies as those described above. However, there are certain parts of the business strategy that need to be updated the soonest possible; reference is made to the HR policies of the firm, which have led to severe complaints by the employees and the development of strikes. The HR strategies of the firm are reviewed in this paper; reference is made specifically to the organizational strategies for employee motivation. Appropriate literature has been used for analyzing and evaluating the firmââ¬â¢s policies in the particular field; emphasis is given on the potential use of the expectancy theory for explaining and managing the lack of employee motivation in the particular organization. Also, strategic tools have been used for describing the firmââ¬â¢s internal and external environment ââ¬â aiming to show the prospects of the firm to resolve effectively the particular organizational problem. The performance of South African Breweries in the local and the global market is depended on a series of factors; the figures included in the firmââ¬â¢s financial statements can be indicators for the firmââ¬â¢s performance up to now and its expected rate of growth. However, in order to identify the firmââ¬â¢s performance in the future it would be necessary to refer to the current market conditions ââ¬â referring to the performance and the trends of the South African beverage industry; moreover, data on the firmââ¬â¢s performance up to now should be presented aiming to show the potentials of the firm to achieve a stable growth in the long term. Strategic tools, like the SWOT analysis and the PESTEL analysis will be employed in order to identify the conditions in the firmââ¬â¢s environment and retrieve information on the barriers that the firmââ¬â¢s has to face in the particular industry. Appropriate literature is also used for indicating the aspects and the pote ntial solutions of the
Friday, August 23, 2019
Compare between two institutions policies Essay
Compare between two institutions policies - Essay Example The recruitment procedure provides an open door opportunity for a large pool of candidates to apply for the diversified posts. Furthermore, recruitment procedure assists the organisation in attracting qualified candidates. Recruitment facilitates to devise a strategic mode of selection procedure which is aligned with the organisational goals and objectives along with the specific human resources requirements (Robert 3-26). Thesis Statement. With these considerations, the report intends to discuss the recruitment processes being followed by Qatar Petroleum and Google Inc. The report primarily desires to compare and contrast the recruitment process of the two institutions. LITERATURE REVIEW OF RECRUITMENT AS AN IMPORTANT FUNCTION OF HRM According to the view of Schuler and Jackson, recruitment is a process in which an organisation can rely upon the internal or the external labour market for absorption of the resourceful candidates. It has been further noted that although at the entranc e level the recruitment process is not that important but it frames a vital part for other jobs of higher level. It is always considered as a vital process as it enables to draw in an extensive amount of resources. In keeping with the importance of recruitment, it can be well articulated that internal recruiting process mainly relates with the promotion criteria (211-219). According to French and Rumbles, â⬠If the HRM function is to remain effective, there must be consistently good levels of teamwork, plus on-going co-operation and consultation between line managers and the HR managerâ⬠(170). In the recent scenario, there have been a number of organisations that are facing problems regarding the accumulation of a pool of quality candidates. The jobs and the vacancies that pertain the requirement of specialised skills and knowledge absorb a longer phase of time (Brown 50-108). COMPARISON AND CONTRAST OF DECISION MAKING PROCESS WITH RESPECT TO RECRUITMENT OF QATAR PETROLEUM AND GOOGLE INCORPORATION Recruitment Process of Qatar Petroleum. In keeping with the recruitment procedure being followed in Qatar Petroleum, it entails basically four steps. The HR recruitment section of the company effectively manages the entire process that starts with the need identification to the job specification. This entire process is executed by the selection and the interview procedures of the resources. On part of the recruitment process of the company, it has been further ascertained that the department managers gain the full support of the HR personnel. Each of the candidates being selected is based upon merit. Furthermore, the selection of the candidates greatly depends upon their basic skills and competencies (Qatar Petroleum, ââ¬Å"
Thursday, August 22, 2019
An overview of the conflict resolution theory Essay Example for Free
An overview of the conflict resolution theory Essay Conflict Resolution Theory In conflict resolution, preconceived notions, also called the natural cognitive sorting processes, are the stimuli that unwittingly foment war. By taking a look at individual and intergroup relations, one can better grasp conflict resolution as a way of mediation which may lessen the probabilities of the outbreak of political violence. This essay takes a close examination of the effect of individual-level models of change to inspire change at the social level. The scaling up the process from individual treatment to social has its strengths and weakness. Controlled communication, sensitivity training, Freudââ¬â¢s hydraulic model, complex mirroring and conscious raising psychotherapy are experimented means in conflict resolution to dissolve conflict at both individual and general levels. The natural cognitive sorting mechanism of dividing people into ââ¬Ëusââ¬â¢ and ââ¬Ëthemââ¬â¢ engenders prejudice and in the long run, political violence. This perspective is typical to The Self and The Other concept in which people and groups are constructed to exclude the other or any entity that is perceived as foreign and to include the self or other entities affiliated to the self. ââ¬Å"Protracted social conflicts typically involve an enduring set of antagonistic perceptions and interactions between communal groupsâ⬠¦negative attributions of motivations and reciprocal negative images perpetuate the antagonisms and solidify the conflictâ⬠(Fisher 1997). This concept breeds the antagonization of groups which turns one group against the other, deepening rifts and sharpening rivalry. Since this type of social cognitive process emphasizes differences between ââ¬Ëusââ¬â¢ and ââ¬Ëthem,ââ¬â¢ an elitism can arise which advantages one group over the othe r and fosters an unhealthy intergroup competition and mutual exclusion. With mutual degradation and demonized motives, each group continues to not only drift apart but rub against each other in a frictional relationship to produce an aggression fire. At the national level, us and them dichotomy leads to jingoism which is a chauvinistic form of nationalism. This ideology promotes the suppression of one and the superiority of a people. Fanatical patriotism and the prejudiced belief propose that another party must suffer in the power imbalance. (Paris 2004) agrees that ââ¬Å"exclusionary forms of nationalism also make enemies of excluded groups.â⬠In other words, one nation categorizes, segregates and disadvantages another. As a consequence, the excluded party harbors resentment toward the opposing group. Resentment begets tension-filled relations, which beget mistrust. The polarizing effect of the ââ¬Ëusââ¬â¢ and ââ¬Ëthemââ¬â¢ construct leads inevitably to suspicion and in a competitive environment, to perceived inequalities. Inequalities result in the categorization of an oppressed and an oppressor, the victimized and the victimizer. At a particular point, one group arrives at a breaking point, demanding the redr ess of wrongs whether real or perceived and an equalizing of the playing field. (Fisher 1997) also recognizes that some ââ¬Å"conflicts arise when identity groups perceive that they are oppressed and victimized through a denial of recognition, security, equity and political participation.â⬠Imbalances of power stimulate one group to react or even retaliate ââ¬â hence hostilities erupt. It was a wave of nationalism which provokes WWII in which the Aryan Germans attempt to purge Germany of ââ¬Ëunwanted elementsââ¬â¢ for the sake of the country. Similarly, in the case of Rwanda and other countries, ethnic cleansing or genocide take place because of inequality and a false sense of nationalism. Sorting out the Natural Cognitive Processes To arrive at conflict resolution, one must broach the theme of altering intergroup perceptions. This method is an individual-to-social strategy in which with a third party intervention, both groups can mutually exchange opinions and feelings. John Burton pioneers and implements a ââ¬Å"casework approach,â⬠a term used in social work to explain the methods implemented to solve an in individual or group problem. Controlled communication signifies a way to forge effective communication habits. Burton asserts that the source of conflict is miscommunication and the source of miscommunication is distorted worldviews or perceptions of the other. In practicing controlled communication, groups can share their prejudices and biases in a setting that diffuses anger and sets a more amicable tone for talks would help improve relations. Also, Leonard Doob advocates sensitivity training which progresses the transition from individual-level change to collective change. He puts forward that a s mall representative group ventilates their perceptions, opinions, and concerns to create awareness and better grasping of group processes. The sensitivity training workshop is similar to a psychological therapy conducted by a third party. Ideas and feelings are shared to increase interpersonal effectiveness. (Toft 2010) declares that giving voice to former combatants is a mechanism in conflict resolution to craft negotiation settlements in which ââ¬Å"renewed violence can be averted.â⬠This rule follows the sensitivity training theory which enhances sympathy and increases chances at understanding and positive change. In Sigmund Freudââ¬â¢s group processes theory, he posits that the groupââ¬â¢s way of thinking is spawned directly from the individualââ¬â¢s. In Freudââ¬â¢s hydraulic model, the principle is that just as it is dangerous to suppress feelings for fear of compounding them for a more violent eruption, so at the social level, it is risky to continually inhibit ill-feeling by conflict resolution (Strachey 1966); instead, venting would help diffuse tensions and instead of internalizing the resentment, the person finds relief in expression. In his work ââ¬Å"Give War a Chanceâ⬠(Luttwak 1999) examines the effect of peacekeeping which only temporarily resolves the issue by satisfying parties. However, he advocates war as the means of reaching a more definitive and longer lasting conflict resolution. Complex Mirroring Complex mirroring within the group setting is a way in which the individual change scalps up to the group level change. In remedying traumatized individuals, the victims join themselves to a group and begin to mirror one anotherââ¬â¢s feelings and experiences. A critic notices that ââ¬Å"by listening to one anotherââ¬â¢s individual presentation of personal experiences, participants gain a new perspectiveâ⬠¦by listening to the series of such descriptions, they gained the experience of universalityâ⬠(Herman 1997). As a result, the individual-level change dynamic transmutes into the group-level change. As one witness the effect of trauma, the support group experiences secondary trauma as wounded members relate their experiences and seek emotional support. The incidence of secondary trauma gives rise to empowerment and awareness. Kathie Sarachild formulated the conscious-raising psychotherapy structures specifically for the individual but which could be used ââ¬Å"to ef fect social rather than individual changeâ⬠(Herman 1997). This method was implemented for rape-victims who were silenced by the violence and trauma inflicted by another. In the scope of social change, political violence is a grave injustice inflicted by one and visited upon the other. A remedial path is a sensitization rather than retaining the silence over the injury. As the publicââ¬â¢s consciousness heightens, a cure has to be suggested and taken. The beneficial result is that ââ¬Å"changes at the individual level were being linked with policy processes at the macro levelâ⬠(Fisher 1997). Conflict Resolution Strengths and Weaknesses In conflict resolution, a strength of the individual to group model application is that groups comprise a conglomerate body in which individual mirroring gradually filters into the groupââ¬â¢s ethics. The reasoning is that a group is comprised of individuals and since a group is made up of individuals, then a method aimed at effecting change in an individual can also be applied to the group. However, this method does not factor in the wide diversity of the individuals belonging to a group. One rigid rule utilized for one individual cannot work for a group because this view only facilitates the one-size-fits-all theory which is not socially viable. References: Fisher, R.J. (1997). Interactive Conflict Resolution, Syracuse University Press, New York. Herman, J.L. (1997). Trauma and Recovery. Basic Books Publishers, New York. Anonymous. (1996). Human Rights in Peace Negotiations, Human Rights Quarterly,18(2), 249- 258. Luttwak, E. (1999). à Give War a Chance, Journal of Foreign Affairs, 78 (4), 36-44 http://www.jstor.org/stable/20049362. Accessed 14 December 2011. Strachey, J. (1966). The Standard Edition of the Complete Psychological Works of Sigmund Freud, The Hogarth Press and the Institute of Psycho-Analysis, Vol. 22, Toft, M.D. (2010). Ending Civil Wars: A Case for Rebel Victory, Journal of International Security, 34 (2), 7-36. Paris, R. (2004). At Warââ¬â¢s End: Building Peace after Civil Conflict. Cambridge University Press.
Wednesday, August 21, 2019
What Excatly Do Evaluators Look for in a Group Discussion Essay Example for Free
What Excatly Do Evaluators Look for in a Group Discussion Essay A group discussion or GD, is a form of many-on-many discussion. It has become an inseparable part of admissions to management institutes and your selection in campus interviews. A GD is held to identify certain traits that companies and institutes like to see in their employees or students. Lets take a look at the traits which the evaluators look out for in a candidate during the GD. Knowledge: Whatever you do in a GD, your knowledge about the subject cant be replaced by anything else. You are required to talk in a GD but inputs that dont contain any substantial value will not help in any way. Be a voracious reader to increase your knowledge on various subjects. Newspapers, TV, magazines, news portals etc are great sources of knowledge. Alertness and presence of mind: In a GD you are required to carefully listen to the other persons thoughts and keep an argument, example or a supportive statement, fact, example ready to participate in the discussion. Here comes into picture your alertness and ability to think and act immediately. As you participate in a GD, make sure that you sit with an attentive mind and keep taking down the relevant points put forward by others. Communication: You may have a lot of good points to put across but if you cant communicate them clearly, you wont stand a chance when it comes to impressing the evaluators. Practice communicating in a clear and effective way with your friends, family or study group. Confidence: Your self confidence adds a lot of value to your candidature. Look at every group member as you speak, avoid too much hand movement and looking at evaluators. Leadership and team skills: Your participation in a GD clearly establishes not only your leadership skills but also your capability to work in a team. To meet the objectives, a good leader has to be a team player. Goal orientation: Since so many people participate in a GD, the chances of the discussion moving away from the subject are high. Your focus on the goal can get you some extra points. Now, as you are being evaluated for the above discussed traits, you must avoid things that can work to your disadvantage and might cost you the selection. Here are some things that you must avoid doing as a GD participant: Initiating the discussion without proper subject knowledge Although initiating the discussion helps you get the immediate attention of the evaluators, sharing irrelevant details just for teh sake of talking can work to your disadvantage. Start first only if you know the subject well otherwise wait for others to start and get a feel of the subject before entering into the discussion. Snatching anothers chance to speak Give your group members a chance to speak. Talking more wont get you through the GD. In fact it will give the evaluators a feeling that you are not a team player. Making short and relevant contributions of 20-30 seconds 3-4 times in the discussion is enough. Interrupting others Let the other person finish his comment before you speak. Interrupting someone is counted as a negative trait. Remember, it is a discussion not a debate. Dont jump at the conclusions. Listen carefully to the other person before putting your point across. Dialogue In a GD you are expected to communicate with all the members of the group. Do not keep looking at one person while talking. Establish eye contact with all the members of the group. It is a many-on-many discussion not one-on-one. Shouting or dominating Keep you emotions in check. Do not try to dominate the others or let your emotions rule you. Sometimes it might happen that a group member might say something that hurts your feelings such as a comment on your race or religion, make sure that you do not get into an argument. Your focus should be to effectively meet the goals of GD topic. Showing off You have to put across your knowledge on the subject during the GD but you have to be very careful about the thin demarcation between showing off and knowledge sharing. For eg, using statistics and facts during the GD is a good thing to do but you must not overdo it enough to nauseate the group members. Low self confidence or insecurities As we have seen earlier, one of the traits evaluated during a GD is your self confidence. Do not hesitate to speak confidently, even if you might be short of ideas or knowledge on the subject. Listen to others and put across your thoughts in a clear and audible voice. Make sure that you make eye contact with all the group members. Slang and negative gestures GD is a formal discussion. Avoid informal words and negative gestures. For e.g. avoid words like gonna, wanna, ya etc. Similarly avoid gestures like pointing fingers, tapping the desk with the pen. If you ensure that you do not commit these mistakes during the GD, you will not have to worry too much about the negative marks and your chances of getting through it also become much brighter.
Tuesday, August 20, 2019
Spinal Muscular Atrophy
Spinal Muscular Atrophy Spinal Muscular Atrophy Spinal muscular Atrophy is a disorder when the spine and muscles are affected. The Neurons on the spinal cord that control movement of muscles are infected and causes the Neurons to shrink and become destroyed and prevents messages coming from the body To the brain and muscles depend on that for proper function. Some muscles are not affected when having SMA like the bladder muscles. Hearing and vision are not affected and intelligence is normal or above average. Investigators have noted that children with SMA can have very high intelligence. There are 3 types of SMA all 3 types are known As autonomic recessive genes. To inherit SMA both parents must give the defective gene in order for the offspring to inherit the disorder. Sometimes SMA is inherited as an autonomic dominant gene. Type 1, 2, and 3 are got from a defected same gene on chromosome #5, different affected chromosomes will have different affects and types of SMA.There is another form of the disease called x-linked spinal bulbar atrophy that arises from a defect in a gene called the androgen receptor gene on the X chromosome. Every form of SMA affects the bones muscles of the trunk and limbs. These muscles are closer to the center of the body and are more infected than other parts that are farther than the body like the fingers. SMA type 1 affects the neurons that control your mouth and throat which makes chewing and eating problems. Type 1 is the most severe of all the types of SMA and is noticed during the first 6 months of birth. Cannot sit without support or a cushion, death is usually occurred before the age of 2. SMA type 2 isnt as worse as type 1 and is noticed during the ages of 7 months to 18 months of age. Cannot sit properly without a cushion or support, cannot learn to walk without any help or assistance has numerous swallowing difficulty some lucky children survive until childhood. Type 3 SMA occurs after the age of 18 months old. Weakness of the muscles in the mouth and throat is not likely to happen. Not as severe as type 1 and 2 but still can cause death if not cared for, children might live up to adulthood SMA is inherited by both parents having the recessive gene is their DNA and the offspring inherits 22 of the non sex chromosomes. When genes are defected they do not function and properly produce the proteins that are needed for a cell to function. A big chain can happen when a little protein is absent when there is too little or too much protein or if it doesnt work right for some reason. In the case of SMA protein abnormalities prevent the normal functioning of motor neurons. SMA causes muscle degeneration and will shrink until muscle weakness happens. SMA is not spreadable because disorders cannot spread from person to person only if parents have the 2 recessive SMA genes. There are no cures or treatments for spinal muscular atrophy right now but researchers and scientist are trying to find a way to get rid of SMA or at least reverse some of the affects that causes death for the young. Some symptoms of SMA are muscle weakness, leg weakness, thin muscles, hard time breathing, hard time eating/swallowing, lack of movement and walking, head control, hard time sitting up, hard time crawling when a baby. SMA affects life span a lot, especially when a child or a baby because you have a high risk of dying because of the disorder. Muscles are weak and have a hard time walking. SMA affects all kinds of people. In 1890 G. Werdnig found about SMA and the first type of the form of SMA. Years later a person named Kugelberg and another person named Welander described the less severe types of SMA and its affects to the human body and muscles. SMA is the most common diagnosis in girls with progressive weakness. It is one of the most common genetic causes of death in children! In the United States it is about 5 out of 100,000 child births that are affected with SMA. In ND (North Dakota) it is about 15 out of 100,000 children that are affected with SMA. SMA seems to be affecting more people in North Dakota then anywhere else in other areas. Males are more common to get SMA other than females, the ratio to males to females is 2:1 although the ratio is 2:1 how long you live with SMA is not affected by sex. Spinal muscular atrophy used to be only affecting black African Americans but years have passed and it is indicated that SMA is not affecting African Americans that much as it used to a while back. Spinal muscular atrophy is caused by the region of chromosome #5 that contains SMN (survival motor neuron) gene has a very abnormal huge duplication. The gene copies its self which causes mutation. The smn2 gene has a another mutation that makes less protein that does it in a very slow level. The most common forms of SMA are caused by the mutation of the SMN gene and affects different areas of the body and makes severe or less severe damages depending on how the gene mutates. Boys that get the gene die before the age of 2, but girls that get the gene are carriers unless they die before having an offspring. There are about 1,386 families that have SMA and 759 females and 776 males that do have SMA. Doctors and researches help with the symptoms and features of SMA to help reduce the chance of death. Doctors talk with children and help babies walk and breath. The spine is dislocated and is not straight. The spine wont function correctly and spine neurons will eventually die out and muscles will die out to.
Two Personalities in My Last Duchess :: My Last Duchess Essays
Two Personalities in My Last Duchess The poem "My Last Duchess" is about a powerful Duke, and his beautiful, flirtatious wife who has two different personalities, one that was reality and the other was the lady in the painting. The poem begins and ends with him mourning the loss of his deceased Duchess, but from the way that the mighty Duke speaks, he knows more about her death than he leads us to believe. The Duke chooses his word very carefully, when he talks to his friend about the painting of his wife. He only drops small hints, to his friend about the death of his Duchess. Which leads me to believe that the Duke killed his wife, or had someone to put her to her death. As the Duke speaks of his Duchess, in the beginning, he sounds extremely compassionate and caring towards her. The Duke had an absolute love for his Duchess as most husbands and wives do.Ã He sounded so proud of her and the beauty that she posed: almost like she was a trophy. Despite all of the pride and excitement that he showed towards her, there was an element of distrust that lingered inside of his mind. The Duchess created the element of distrust that was bestowed into the marriage. The Duke explained that his wife was extremely flirtatious and easily impressed. The Duke said, "Too easily impressed: she liked whate'er she looked on, and her looks went everywhere." This line is telling about the Duchess, as she was when she was alive. The Duke believes that his Duchess is a cheat, and that she doesn't try to hide it either. A husband can tell when his wife is interested in another man, cause she once looked upon him in that way she is looking upon her new male interest. The Duchess probably didn't know that her husband was watching her, while she was taking interest to her lovers. She may have thought that she and her male interest at the time were alone, cause not any woman, in that era would have been seen with another man besides their husbands. Given the fact that this poem dates back to the Duke and Duchess era, so they lived in an old fashioned world. The Duke believes his wife is not being faithful to him.
Monday, August 19, 2019
Stones From The River Essays -- essays research papers
Ursula Hegi's novel, Stones From The River, exposes the reader of the persecutions of religious beliefs, a gossiping dwarf, and the people of Burgdorf, a small German town in the time of the Nazi Holocaust. The novel is set in World War I and continues through World War II. The Second World War is brought on by the hunger of power it is known as the otherness war. 'In the Third Reich otherness is a crime.';(Chadwick 2) Hitler, a Nazi leader, wants to gain control of Germany and surrounding countries. Hitler is a feared name even in our society today. We see things through the narrator's eyes. The novel has many flat characters in it. However, some characters are more developed than others are. Each character has a connection to the narrator whether he/she is a friend, a neighbor, or a bully at school. This novel is unique to Hegi because of her background. She lives in a 'suburb of 'Dusseldorf'; before she immigrates to the United States in 1965'; (Simon 1). It was unusual for her to write about this because the people who survive the holocaust never will talk about the past, they all believe in the 'tight lip' philosophy. In the novel Jews, Catholics, and Protestants become victims of the Nazis. Religious prejudices are common throughout the novel. However, Hegi portrays Catholicism as the primary faith. The author scatters many fairy tales and stories inscripted about the different types of religion throughout the text. 'Catholic water rusted Jewish cars.';(Hegi 88) However, the priest says, 'Protestant babies [are] pagan babies…and the Jewish babies [are] like Protestant babies,'; because they are not christened. (Hegi 58) In both the Jewish and Catholic religion different beliefs and celebrations bring commeraderie to the inhabitants of Burgdorf. While the Jews believe that Jesus is an exemplary man, but not God incarnate, the Catholics believe that Jesus lived and has died for our sins at the hands of the Romans. Catholics celebrate the Christ's Last Supper by receiving communion, a major sacrament in Catholicism because; communion in the Catholic Church is believed to be the body and blood of Jesus. It is believed that when one receives communion that all of one's sins will be wiped away. During the month of December the Jewish celebrate Hanukkah, while the Catholics celebrate St. Nikolaus and Christ's birth in Christmas. We celebrate his ... ...fferent than the rest provided a peaked interest to Max. He cares for her uniqueness not because she is different. Couples in today's society are always trying to change people and make them someone they are not. If one thinks they are going to change a person's personality and actions. Then they need to step back and take a good look at them maybe they are the ones who need to change. Stones From the River, is a wonderful novel. Hegi takes us through the World Wars and explains to us the affects they have on our society. Trudi in the novel takes in and helps shelter those who are hiding from the law. She believes that god put her here to help others and she does, with her gift of storytelling. If we all took the time to help one another than we should all get along. Jews, blacks, gays, and cripples are looked down upon. We are programmed to see people's flaws and to discriminate against those who have these differences. Many colleges have a diversification program that it sends all students through, but this is not solving our ignorance of race or gender. If we as a society become well educated on the horrific affects of our actions we could all live as one race, the human race.
Sunday, August 18, 2019
Proteins Essay example -- science
Proteins Proteins are the macromolecules of life. Discovered in 1838, proteins are recognized as a large number of superior organic compounds that make up living organisms and are essential to their functioning. The term protein comes from the Greek word ââ¬Å"proteiesâ⬠or ââ¬Å"primaryâ⬠. Proteins have many different properties and function in a variety of ways. They can function as a building material, in teeth, bones and muscles, and they can serve as enzymes, hormones, and neurotransmitters. Its functions are the most diverse of any family. Whether found in humans, animals, plants or in single-celled bacteria, proteins are made of units of 20 different amino acids. Proteins consist of macromolecules called polypeptides, made from monomers called amino acids. Proteins have hundreds, thousands, or sometimes even millions of these amino acids. These amino acids are made up of carbon, hydrogen, oxygen, nitrogen, and sometimes sulfur. Some proteins consist of only single polypeptides. In most cases it involves two or more combined polypeptides, sometimes with other small organic molecules or metal ions. The most basic level of protein structure, called the primary structure, is the linear sequence of amino acids. Different sequences of the acids along a chain, however, affect the structure of a protein molecule in different ways. Proteinââ¬â¢s secondary structure often contains long stretched out chains of amino acids called strands that line up together to make sheets. These are called beta strands and the sheets are called beta-pleated sheets. A protein may contain either or both alpha helices and beta pleated sheets. Alpha helices and beta pleated sheets are joined by less clear structures often grouped together under the name of coil. Some small proteins may be made of coil. Shape is also important. Proteins are coiled and twisted, giving it a unique shape. The shape depends on the sequence of the amino acids, which can be hydrophilic or hydrophobic. Those that are hydrophilic want contact with water and will be twisted to maximize contact. Those that are hydrophobic are twisted in such a way to minimize contact. Changing one amino acid in the polypeptide sequence can destroy this shape and make the protein function improperly if not at all. A very important function that proteins can serve are to act as catalysts. Enzymes are organic catalysts ma... ... cells their shape and as well as parts of the linkages that stick cells together into tissues and organs. So, the sequence of amino acids in all proteins is genetically determined by the sequence of nucleotides in cellular DNA. So basically Proteins are basic constituents in all living organisms. They are complex molecules composed of amino acid and necessary for the chemical processes that occur in living organisms. Proteins are sometimes referred to as macromolecular polypeptides because they are very large molecules and because the amino acids of which they are composed are joined by peptide bonds. The vast majority of the proteins found in living organisms are composed of only 20 different kinds of amino acids, repeated many times and strung together in a particular order. Each type of protein has its own unique sequence of amino acids. Also each protein makes every living organism different. Bibliography: 1. Proteins, Lexicon Universal Encyclopedia, 1989 Volume 15, pg.576. 2. www.biotech.imcb.edu.com 3. http://www.faseb.org/protein.html 4. ââ¬Å"Proteinsâ⬠. SceinceDaily.à ¾2000 à ¾www.sceincedaily.com 5. ââ¬Å"Proteinsâ⬠. Britannica Online 2000 à ¾www.britanncia.com
Saturday, August 17, 2019
Analysis of Priceline
Priceline Inc. is an online travel booking site that helps customers worldwide purchase airfare, hotels, rental cars, and much more. The three categories I chose to analyze are business model and strategies, business finances, and expansion of the company through acquisitions. For Priceline to have success, I believe the business model and how the company builds its model is extremely important. Next, it is crucial that we look at the finances of the company to ensure it is profitable. The finances of the company are tied to the various acquisitions Priceline has acquired in the past few years. By looking at the companies Priceline has acquired, I strongly recommend investing in Priceline based off of the record earnings posted by the company. Not only is Priceline profitable, the corporation also has an unique business strategy to make money. When assigned this paper, I began to use databases and Factiva to search for information about Priceline. I used the information found from da tabases and used them as research to support my report. I then researched Pricelineââ¬â¢s marketing techniques as well as stock prices in order to elaborate on the companyââ¬â¢s finances. Finally, I learned about the companies Priceline has acquired over the years to expand its market presence. To figure out the formatting and structure of this paper, I used other peopleââ¬â¢s reports as guidance.IntroductionPricelineââ¬â¢s business model includes value proposition of connecting vendors and customers. It consists of a revenue model where there are transaction fees and spread earned by the company between vendor and customer price. Launched in 1998, Priceline Inc. does not directly supply travel services, but rather they bring buyers and sellers together to complete a transaction. Priceline saves consumers money by trading travel flexibility of brands and product features for sellersââ¬â¢ lower prices. Business Model and StrategiesEver since the development of the inte rnet, dot-com companies have been booming left and right. One of those companies founded during the dot-com boom was Priceline Inc., an online travel booking site that revolutionized the way consumers purchased air tickets, hotel rooms, rental cars, and much more. Priceline Inc. developed and innovated a new system of ââ¬Å"Name your ownà priceâ⬠for customers to finalize their travels. They were able to turn excess inventory otherwise not sold by the airlines to consumers while at the same time price discriminate in order to maximize profits. In the airline industry, it is estimated that only 65% of the seats on a plane are occupied on a daily basis.Airlines definitely were looking a way to vend the rest of the inventory. However, they could not advertise these excess seats with special discount because in doing so, it would destroy its retail fare structure. Priceline was the solution to this as they are able to help shield airlines branding in two different ways. First, w hen consumers try to name your own price on Priceline, they must choose travels between two cities. In this case, the airlinesââ¬â¢ branding and product configurations are protected as customers have no idea which airline they will be selecting. Only after a bid is accepted will they learn their exact flight information and itinerary. Secondly, Priceline protects those who are considered free riders. These are people who would receive the benefit of a discount but they are already willing to pay for an air ticket at a higher price (Eisenmann 47-48). Name Your Price GuaranteeFigure 1.1Source: (Priceline.com) Revenue Generation: Priceline is able to effectively generate revenue one of two ways. First, it calculates a spread between the lowest prices offered by the Airline partner and the highest prices a customer is willing to pay. In this scenario, neither party the airline partner nor the customer have the option of knowing the asking price or the bid price. A customer has no ide a what unpublished rate the airline is offering. Only Priceline would have this secret information. On the other hand, the airline does not get to see how much the consumers bid on the air ticket. For example, if a customer bids $300 on a ticket from LAX to JFK and the lowest unpublished rate for any given airline is $200, then the spread would be $100, which Priceline retains as its earnings. As seen from this model, profiting from the spread is highly successful given the economies of scale from customers (Eisenmann 47-48). Adaptive Marketing and Cross Subsidy:Furthermore, Priceline also offers consumers to bump up their bids by participating in ââ¬Å"adaptive marketingâ⬠and ââ¬Å"cross-subsidyâ⬠promotional programs. For instance, Priceline could add $50 to an existing $100 bid to make it more likely that a ticket will be sold if one signs up for a credit card. If that is the case, the credit card company may pay Priceline $75 for every referral that signs up for the card. In this case, Priceline would simply pocket the difference. If the asking price for the ticket was already under $100, then Priceline would keep all of the money coming from credit card sponsorship (Eisenmann 48).Business Finances Early Stages of Priceline: At the beginning of year 2000, Priceline had a market share of 3% of all airline tickets sold in the U.S. Attracting over 3.8 million unique visitors, Priceline sold tickets for all eight domestic airlines as well as 20 international carriers. One year after its establishment in 1998, Pricelineââ¬â¢s revenue was $482 Million in 1999 and $1 Billion in 2000 (Eisenmann 48).However, the dot-com bubble would halt Pricelineââ¬â¢s success only temporarily. 1999 was a tough year for Priceline as it stated a $1.1 Billion loss on its financial statement. Stock prices plunged from $974 to $7 a share. According to Walker, ââ¬Å"there was a credibility issueâ⬠within the organization and investors did not completely trust t he dot-com industry. Pricelineââ¬â¢s financials would improve slowly. In 2002, Priceline reported a net loss of $19 Million. When CEO Jeff Boyd took over the company in 2002, Priceline stocks had suffered one of the worst drops in its brief history. But soon enough, Priceline was able to make a turnaround when it introduced William Shatner as the negotiator character out of the blue to help consumers save money. Instantaneously, people remembered the advertisements put up by Priceline and associated with Shatner, a former Star-Trek starââ¬â¢s self-parody. William ShatnerFigure 1.2Source: (Thepenaltyflagblog.com) From Loss to Profit: Priceline started making a profit in 2003, but it wasnââ¬â¢t until 2004 and 2005 when Boyd bought two European hotel reservation sitesââ¬âthe U.K.'s Active Hotels and Amsterdam-based Booking.com that Priceline hit a turning point. ââ¬Å"Priceline's earnings growth and stock market success since then have been attributable largely to those t wo acquisitionsââ¬âBooking.com in particular. It would be tough to argue that there's been a better acquisition in Internet history,â⬠says Thomas White, an analyst at Macquarie Securities. ââ¬Å"It's why the stock has been such a home run,â⬠says White.Thomas White and Barclays' DiClemente would agree that investors lack the knowledge that most of the revenue come from overseas. Since Europeans have many more vacation days as Americans, it is not surprising that more revenue is inflowing from Europe. Jeff Boyd, the CEO of Priceline, was smart about targeting such a market in Europe. ââ¬Å"Moreover, the growth of discount airlines in Europe such as EasyJet and Ryanair have increased the popularity of ââ¬Å"city breaksâ⬠ââ¬âthe European equivalent of a weekend getaway,â⬠states Birger. Earnings Report in 2012:In 2012, Priceline continued to post better than expected earnings reports. In the third quarter of 2012, Priceline reported third quarter revenue s of $1.71 Billion, up 17.4% from a year ago in 2011. Also, Priceline beat the estimate of $1.65 Billion projected revenue determined previously by analysts. Non-GAAP profits stood at $12.40 a share, ahead of the estimate of $11.81 a share. Gross bookings came in at $7.8 billion, elevated 25.2% from a year ago. For quarter four in 2012, Eric Savitz of Forbes magazine states ââ¬Å"Priceline projected revenues to be up 21-28% or 22%-29% in local currency; revenues are expected to improve 15%-22%, with non-GAAP profits of $6.12 to $6.57 a share. Consensus has been for $6.34 a share.â⬠Continuous Growth: In the mean time, CEO Jeff Boyd continues to have high hopes for Priceline. ââ¬Å"Globally our hotel business grew room nights by 36% over the same period last year, compared to 39% growth in the second quarter,â⬠he said. ââ¬Å"Our rental car business grew rental car days by 35% over last year, an acceleration from 29% in the second quarter, led by improving results at Pric eline.com and continued strong growth from Rentalcars.com. While we remain concerned about economic weakness across Europe, Asia and the U.S., the [company] intends to focus on solidifying its position as the world's largest and most profitable online hotel reservation service by continuing to add hotels and other accommodations and better servicing our customers through constant innovation in our mobile and desktop sites.â⬠As promised by Boyd, Priceline continued to show tremendous growth. On November 1st, 2012, Priceline stock was up $12.22 in regular session trading and jumped another $52 a share in after-hours trading to close at $638.95 (Savitz). Since then, Priceline sustains its momentum by reporting record earnings in the preceding quarters. Today, stock price for Priceline is even higher than few years ago. It currently trades at over $1,000 a share and constantly out competes against their rivals Expedia and Orbitz (Birger).10 Year Graph of Priceline (PCLN) Figure 1.3 Source: (Yahoo Finance) Acquisitions and Expansions Booking.com: Priceline is on track to make a very good move because it is believed that the online travel reservation market still has room for expansion in Europe. Priceline typically takes 15% of every transaction done on Booking.com; in return, the hotels have a much better chance to market and advertise to potential customers. After Pricelineââ¬â¢s acquisition of Booking.com in July 2005 for $135 Million, its profits skyrocketed from $10 million in 2003 to $1.1 billion in 2011. No other acquisition has proven to be that successful in the 2000ââ¬â¢s (O'Neill). Agoda and TraveljigSaw:In addition, Priceline is increasing its brand in Asia via its Agoda brand and it is growing its rental cars division as well, aided by a 2010 acquisition of global car-rental site TravelJigsaw. Ever since these acquisitions of smaller travel companies, Priceline is able to expand its market cap while its stock prices surged over 500% in the fo llowing five years (Birger). Kayak:In 2012, Priceline Inc. continues its acquisition practice with the purchase of Kayak for $1.8 Billion. Shareholders of Kayak received $40 per share. Kayak is successful in that it raised $91 Million in the July 2012 IPO through selling of 3.5 Million shares at $26 apiece. It has processed 302 million queries across its web. Kayak and Priceline are ââ¬Å"two of the largest online-travel companies and it makes sense that these two companies would want to work together, of course, because they do have different strengths and different objectives,â⬠said Dan Marcec, an analyst at Emarketer. With the acquisition of Kayak, Jeff Boyd states that ââ¬Å"Pricelineââ¬â¢s intention is for Kayak to be operated independently under the leadership of existing management, as with our other hands, with a primary focus on building value for its customers and advertising partnersâ⬠(Levy).Conclusion Priceline Inc. operates as one of the biggest travel booking sites in the world. Its global presence in Europe and Asia as well in the Americas cannot be ignored. Priceline Inc. should be a company that is to be heavily invested in because of its revenue and profit posted by the corporation. Its record breaking earnings in the billions should easily attract the eyes of a savvy investor. Priceline will continue to post earnings through the way it does business by matching consumers with vendors and earning the difference in prices. With its continuous acquisitions of smaller booking sites, Priceline is set on par to be the dominant and primary go to website when it comes to travel bookings. Without a doubt, its stock prices will continue to soar as it expands its presence in Asia.
Friday, August 16, 2019
What Is the Effect of Lack of Sleep on College Students?
Running head: WHAT IS THE EFFECT OF LACK OF SLEEP ON A COLLEGE STUDENT'S BRAIN AND BEHAVIOR Gilbert and Weaver (2010) examined the sleep quality with academic performance with university students, whether it is complete sleep deprivation or poor sleep quality. This study was to determine if lack of sleep or having poor sleep value in non-demoralized college students were related to the low academic routine. The authorââ¬â¢s expectations were to find the relationship between the studentââ¬â¢s environment and lifestyle with their sleep patterns and the force it has on their educational performance.Within the study the authors found that being able to have good sleep patterns and quality is a big key part for student to have a good GPA and being able to pass all their academics. Yet, a huge portion of college students do not get plenty or a fair amount of sleep. The authors also found in their study that students should be more considerate on the sleep value and sleep amount they should have. To the authors awareness, This is the first study to have found a relationship between poor sleep quality and lower academic performance using a large sample size and importantly, for non depressed students alone. Gilbert and Weaver, 2010). This study will provide my research with the important factors of sleep and education for a college student, in order to foresee the academic routine on the studentââ¬â¢s foundation of sleep quality and quantity. Also it would provide my study with the question of whether our society should start regulating students to sleep enough to perform better, or instead let the students perform as they are doing. The author could not prove that poor sleep patterns resulted in a lower GPA for students, they only knew the important contributions that pointed to the conclusions of the study.Another limitation was that when the author performed the study, they only performed the study on freshman college students and not any higher level colle ge students. Lastly, they didn't check the University transcripts for the studentââ¬â¢s grade point average; they relied on the studentââ¬â¢s honesty. Mateika, Millrood, and Mitru (2002) examined the consequences of sleep on learning performance and the behavior that results from lack of sleep, in adolescents. The authors did the study to see the different options to help students re-establish and balance their normal sleep and everyday routine.The expectations of authors were to find a solution to help young adults in preventing the cause of their lack of sleep, whether it was from their parents, the school, work, or medical reasons. From all the different perspective views of the authors, they found that, the side effects that manifest was a consequence of sleep deprivation are independentâ⬠¦include inattention and poor performance in the classroom and emotional and behavioral changes. (Mateika, et. al. , 2002). With that, they looked at different changes they could make , like changing the time of when school starts, or looking if the students had sleep disorder.They found that parents and school should help increase the promotion of healthy sleep patterns for the importance of the sleep on school and work performance and behavior in the student. This study provides a different perspective of how to deal with sleep deprivation, instead of looking at the students sleep patterns and lifestyle and changing that, this study looks at how parents, or schools can be change the lack of sleep in order for students to perform better in their school and work environment.This provides my study with the mentality that students are mostly not to blame for their own lack of sleep, the blame can be from the amount of workload the students get from their teachers, the time they go to school and leave, the time they go to work and leave work, or even the amount of time not being able to sleep due to stress or insomnia. So all this gives me different perspectives to look at in order to solve the problem of the cause of sleeplessness.The only limitation in this study is that when looking at school workload being increased and the early time of class becomes a bit of a problem with the amount of sleep the student loses and gains. Cruess and Wells (2006) examined the results of sleeplessness on the consumption of food and food choices, which may have a lead problem to health in issues to those who have, sleep deprivation, The authors did this study to show the link between sleep and food intake within college students.They believe that students who sleep less would choose them food that is less healthy, because the students are less concerned of their weight and more dependent on their mood and expediency. The authors expect to see more evidence showing that stress hormones are related with the relationship between sleeping and eating, which in other words, increases in stress lead to more snacking and a decrease in the consumption of typical meal -type foods (Oliver and Wardle, 1999).In their study they found that what they expected to find in the beginning had happened, in which there was a difference in food intake, measured by how much calories was consumed after the night of the students incomplete lack of sleep. The study also presented that there was a huge difference in food consumption and calorie intake on partial sleepless night and a normal night of rest.This study provides my research with the behavior of food with the student, how sleep deprivation can affect a studentââ¬â¢s choice in food, which is chosen by the mood of the student, their health, the price, the convince, the familiarity and the students appeal towards the food, in which it all goes back to whether they had a normal nights rest, or sleepless night. There are many limitations to this study, the main limitations was that this study was based mostly on self-report information, which means that it may or may not be accurate information in the stu dy.Another important limitation was that some of the participants in the study had recorded the start of their food and sleep records in their journals on different days, which made it hard to frame the time of the study accurately. Moreno, Louzada, and Pereira (2010) examined the role of ecological aspects in sleep duration among adolescents who have less technology and adolescents who have advance technology and how it changes the relationship of their sleep patterns.The authors performed this study to bring out an opportunity to look at natural and ecological influences on different characteristics that is related to sleep behaviors; the authors wanted to understand why adolescents who have electric lights, and other high advance resources have a higher level of sleep deprivation, while those who have less technology have enough sleep and are able to perform better. Their expectation for the study was that there would be an interaction between the natural and ecological factors i n the sleep cycle of the adolescents.The study help the authors find that the occurrence of electric lighting in home of the adolescent is a critical factor that is related to the duration of the sleep, which results in regular amount of sleep to irregular amount of sleep in adolescents. These results are important in my study, because it supports the ideas that adolescents having advanced technology, is important when determining whether it is a factor in knowing it results in sleep deprivation. Kopasz et. al. 2008) examined that adolescent to not sleep enough and have different sleep patterns every day, due to adolescents decrease in sleep duration on school days and increase in the weekends. The purpose of this study for the authors was to find the relation between adolescents sleep schedule, the environments of the student and daytime tasks, and to look at the results with the sleep records the adolescents kept. The expectations of this study were to find a difference between th e sleep patterns of during the week and the weekends, and the difference between the ages of the students and how late or early they slept.The authors found what they were expecting, there was a significant difference between week and weekend nights, and the older students slept about an hour less per night compared with the youngest. (Kopasz, 2008). They found as our age increases, are sleep duration decreases. This study is important to my research, because it shows a new perspective of the topic, where it gives evidence of how our generation grows, we lose more sleep because of the changes in education, in life events, and our society.This study shows how teenager are suffering the consequences of having sleep deprivation due to having to work and go to school, on top of family issues and the workload teachers give students. This is important to my study because the authors foretell that sleep deprivations in found adults is a global problem with severe consequences. The inconsis tencies in the body of research are that there is not much research or experiments in the relationship of sleep and the brain with a college student.There is much said about students behaviors with there is lack of sleep in their daily routines, but to know what happens, or what goes on in the brain, when it suffers from sleep deprivation will give my study a better perspective of the bigger picture. The gap that are in the body of this literature review is important, because it gives my study resources to look at and explore in which the other studies did not. My study will do research in both the brain and the behavior in all levels of non-depressed college students who have sleep deprivation and figure out what is the main cause of the students lack of sleep in their college lifestyle.References Gilbert, S. P. , and Weaver, C. C. (2010). Sleep Quality and Academic Performance in University Students: A Wake Up Call For College Psychologists. Journal Of College Student Psychotherap y, 24(4), 295-306. doi: 1080/87568225. 2010. 509245. Mateika J. H. , Millrood, D. L. , and Mitru, G. (2002) The Impact Of Sleep On Learning And Behavior In Adolescents. Teachers College Records, 104(4), 704-726. doi: 10. 1111/1467-9620. 00176. Cruess, D. G. , and Wells, T. T. (2006). Effects of Partial Sleep Deprivation On Food Consumption And Food Choice. Psychology & Health, 21(1), 79-86. doi: 10. 1080/1476820500102301. Oliver, G. and Wardle, J. (1999). Perceived Effects Of Stress On Food Choice. Physiology and Behavior, 66, 511-515. Moreno, C. C. , Louzada, F. , and Pereira, E. (2010). Not All Adolescents Are Sleep Deprived: A Study Of Rural Populations. Sleep And Biological Rhythms, 8(4), 267-273. doi: 10. 1111/j. 1479-8425. 2010. 00458. x. Kopasz, M. M. , Loessi, B. B. , Riemann, D. D. , Valerius, G. G. , Voderholzer, U. U. (2008). Are Adolescents Chronically Sleep-Deprived? An Investigation Of Sleep habits Of Adolescents In The Southwest Of Germany. Child: Care, Health, And De velopment, 34(5), 549-556. doi: 10. 1111/j. 1365-2214. 2008. 00845. x.
Thursday, August 15, 2019
Bio 201 Final Review
Which of the following is most likely to occur when a tumor-suppressor gene is mutated? ââ¬â The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. ââ¬â TRUE ________can convert proto-oncogenes into oncogenes. ââ¬â Nonsense mutations Most human embryos that are aneuploidy ââ¬â are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. ââ¬â FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? ââ¬â 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. ââ¬â BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? ââ¬â mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called ââ¬â maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â â¬â are on the same chromosome. An episome is ââ¬â a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. ââ¬â FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. ââ¬â an F factor What can be inferred from an organism that has undergone a gene knockout? ââ¬â The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? ââ¬â identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? ââ¬â G1 Certain types of cancer are caused by viruses. ââ¬â TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as ââ¬â both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to ââ¬â get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? ââ¬â random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain ââ¬â All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. ââ¬â FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. ââ¬â TRUE Which of the following does not contribute to the infectious ability of prions? ââ¬â Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that ââ¬â their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? ââ¬â Plant cells are totipotent. Which of the following is an advantage of molecular pharming? ââ¬â The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp ââ¬â base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. ââ¬â FALSE A gene created from the fusion of two gene fragments is considered a ââ¬â chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. ââ¬â FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. ââ¬â 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? ââ¬â F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that ââ¬â two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. ââ¬â FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is ââ¬â codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance ââ¬â can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â â¬â competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that ââ¬â their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. ââ¬â TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? ââ¬â xeroderma pigmentosum Cancers originate from a single cell. ââ¬â TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? ââ¬â two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? ââ¬â centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? ââ¬â 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? ââ¬â Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. ââ¬â TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because ââ¬â All of the statements given are true. Quantitative traits ââ¬â are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | ââ¬â 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. ââ¬â TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is ââ¬â a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. ââ¬â TRUE Which of the following is a possible use for gene cloning? ââ¬â All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? ââ¬â Every band matches. What is required for a group of clones to be considered a contig? ââ¬â The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? ââ¬â nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be ââ¬â metastatic. The process by which haploid cells are produced from diploid cells is called ââ¬â meiosis In a haploid dominant species ââ¬â the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that ââ¬â alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? ââ¬â both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? ââ¬â either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called ââ¬â epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. ââ¬â 3,2Drugs that are HIV protease inhibitors ââ¬â prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. ââ¬â TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â¬â TRUE The entire collection of a species' proteins is known as its ââ¬â proteome Which of the following pollutants could be reduced with the use of bioremediation? ââ¬â All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. ââ¬â TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? ââ¬â a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. ââ¬â FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) ââ¬â oncogene The formation of the bivalent during meiosis ââ¬â contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. ââ¬â 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. ââ¬â TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. ââ¬â FALSE Which of the following statements correctly describes a quantitative trait? ââ¬â People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. ââ¬â a sex pilus, single strand of DNA Integrase ââ¬â cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? ââ¬â cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage ââ¬â TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. ââ¬â FALSE In mammals, males are ________ and females are ____________. ââ¬â hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. ââ¬â 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. ââ¬â cytoplasm Place the following events of bacterial transformation in order from first to last. ââ¬â DNA replication b â â¬â an enzyme joins F factor DNA ends c ââ¬â sex pilus shortens d ââ¬â DNA transfer e ââ¬â an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? ââ¬â plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? ââ¬â They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? ââ¬â tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. ââ¬â two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. ââ¬â TRUE The sex of all animals is determined by chromosomes. ââ¬â FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? ââ¬â missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? ââ¬â Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that ââ¬â the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission ââ¬â All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. ââ¬â supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? ââ¬â A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. ââ¬â checkpoint proteins In mitosis, the main difference between plant and animal cells is that ââ¬â plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? ââ¬â the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? ââ¬â Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? ââ¬â direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce ââ¬â a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? ââ¬â 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in ââ¬â an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant ââ¬Å"rescueâ⬠could have been caused by â⠬â addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? ââ¬â Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? ââ¬â cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone ââ¬â gene amplification. All of the following are chemical mutations EXCEPT ââ¬â X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? ââ¬â Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is ââ¬â pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? ââ¬â Triple X syndrome Prokaryotes ââ¬â include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to ââ¬â All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. ââ¬â S Sexual life cycles include both haploid and diploid stages. ââ¬â TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce ââ¬Å"Labradoodlesâ⬠is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow ââ¬Å"Texas Beautyâ⬠rose with a true-breeding ââ¬Å"Rubyâ⬠red rose, you get all red roses. But when you cross a ââ¬Å"Texas Beautyâ⬠yellow with the yellow variety ââ¬Å"Jealousy,â⬠you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? ââ¬â The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? ââ¬â All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins ââ¬â do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because ââ¬â if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. ââ¬â IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because ââ¬â HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in ââ¬â the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? ââ¬â polymerase chain reaction (PCR) Polyploidy in plants ââ¬â All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, ââ¬â chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because ââ¬â they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? ââ¬â 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? ââ¬â A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.
Subscribe to:
Posts (Atom)