Spinal Muscular Atrophy

Spinal Muscular Atrophy Spinal Muscular Atrophy Spinal muscular Atrophy is a disorder when the spine and muscles are affected. The Neurons on the spinal cord that control movement of muscles are infected and causes the Neurons to shrink and become destroyed and prevents messages coming from the body To the brain and muscles depend on that for proper function. Some muscles are not affected when having SMA like the bladder muscles. Hearing and vision are not affected and intelligence is normal or above average. Investigators have noted that children with SMA can have very high intelligence. There are 3 types of SMA all 3 types are known As autonomic recessive genes. To inherit SMA both parents must give the defective gene in order for the offspring to inherit the disorder. Sometimes SMA is inherited as an autonomic dominant gene. Type 1, 2, and 3 are got from a defected same gene on chromosome #5, different affected chromosomes will have different affects and types of SMA.There is another form of the disease called x-linked spinal bulbar atrophy that arises from a defect in a gene called the androgen receptor gene on the X chromosome. Every form of SMA affects the bones muscles of the trunk and limbs. These muscles are closer to the center of the body and are more infected than other parts that are farther than the body like the fingers. SMA type 1 affects the neurons that control your mouth and throat which makes chewing and eating problems. Type 1 is the most severe of all the types of SMA and is noticed during the first 6 months of birth. Cannot sit without support or a cushion, death is usually occurred before the age of 2. SMA type 2 isnt as worse as type 1 and is noticed during the ages of 7 months to 18 months of age. Cannot sit properly without a cushion or support, cannot learn to walk without any help or assistance has numerous swallowing difficulty some lucky children survive until childhood. Type 3 SMA occurs after the age of 18 months old. Weakness of the muscles in the mouth and throat is not likely to happen. Not as severe as type 1 and 2 but still can cause death if not cared for, children might live up to adulthood SMA is inherited by both parents having the recessive gene is their DNA and the offspring inherits 22 of the non sex chromosomes. When genes are defected they do not function and properly produce the proteins that are needed for a cell to function. A big chain can happen when a little protein is absent when there is too little or too much protein or if it doesnt work right for some reason. In the case of SMA protein abnormalities prevent the normal functioning of motor neurons. SMA causes muscle degeneration and will shrink until muscle weakness happens. SMA is not spreadable because disorders cannot spread from person to person only if parents have the 2 recessive SMA genes. There are no cures or treatments for spinal muscular atrophy right now but researchers and scientist are trying to find a way to get rid of SMA or at least reverse some of the affects that causes death for the young. Some symptoms of SMA are muscle weakness, leg weakness, thin muscles, hard time breathing, hard time eating/swallowing, lack of movement and walking, head control, hard time sitting up, hard time crawling when a baby. SMA affects life span a lot, especially when a child or a baby because you have a high risk of dying because of the disorder. Muscles are weak and have a hard time walking. SMA affects all kinds of people. In 1890 G. Werdnig found about SMA and the first type of the form of SMA. Years later a person named Kugelberg and another person named Welander described the less severe types of SMA and its affects to the human body and muscles. SMA is the most common diagnosis in girls with progressive weakness. It is one of the most common genetic causes of death in children! In the United States it is about 5 out of 100,000 child births that are affected with SMA. In ND (North Dakota) it is about 15 out of 100,000 children that are affected with SMA. SMA seems to be affecting more people in North Dakota then anywhere else in other areas. Males are more common to get SMA other than females, the ratio to males to females is 2:1 although the ratio is 2:1 how long you live with SMA is not affected by sex. Spinal muscular atrophy used to be only affecting black African Americans but years have passed and it is indicated that SMA is not affecting African Americans that much as it used to a while back. Spinal muscular atrophy is caused by the region of chromosome #5 that contains SMN (survival motor neuron) gene has a very abnormal huge duplication. The gene copies its self which causes mutation. The smn2 gene has a another mutation that makes less protein that does it in a very slow level. The most common forms of SMA are caused by the mutation of the SMN gene and affects different areas of the body and makes severe or less severe damages depending on how the gene mutates. Boys that get the gene die before the age of 2, but girls that get the gene are carriers unless they die before having an offspring. There are about 1,386 families that have SMA and 759 females and 776 males that do have SMA. Doctors and researches help with the symptoms and features of SMA to help reduce the chance of death. Doctors talk with children and help babies walk and breath. The spine is dislocated and is not straight. The spine wont function correctly and spine neurons will eventually die out and muscles will die out to.

Two Personalities in My Last Duchess :: My Last Duchess Essays

Two Personalities in My Last Duchess The poem "My Last Duchess" is about a powerful Duke, and his beautiful, flirtatious wife who has two different personalities, one that was reality and the other was the lady in the painting. The poem begins and ends with him mourning the loss of his deceased Duchess, but from the way that the mighty Duke speaks, he knows more about her death than he leads us to believe. The Duke chooses his word very carefully, when he talks to his friend about the painting of his wife. He only drops small hints, to his friend about the death of his Duchess. Which leads me to believe that the Duke killed his wife, or had someone to put her to her death. As the Duke speaks of his Duchess, in the beginning, he sounds extremely compassionate and caring towards her. The Duke had an absolute love for his Duchess as most husbands and wives do.   He sounded so proud of her and the beauty that she posed: almost like she was a trophy. Despite all of the pride and excitement that he showed towards her, there was an element of distrust that lingered inside of his mind. The Duchess created the element of distrust that was bestowed into the marriage. The Duke explained that his wife was extremely flirtatious and easily impressed. The Duke said, "Too easily impressed: she liked whate'er she looked on, and her looks went everywhere." This line is telling about the Duchess, as she was when she was alive. The Duke believes that his Duchess is a cheat, and that she doesn't try to hide it either. A husband can tell when his wife is interested in another man, cause she once looked upon him in that way she is looking upon her new male interest. The Duchess probably didn't know that her husband was watching her, while she was taking interest to her lovers. She may have thought that she and her male interest at the time were alone, cause not any woman, in that era would have been seen with another man besides their husbands. Given the fact that this poem dates back to the Duke and Duchess era, so they lived in an old fashioned world. The Duke believes his wife is not being faithful to him.

Stones From The River Essays -- essays research papers

Ursula Hegi's novel, Stones From The River, exposes the reader of the persecutions of religious beliefs, a gossiping dwarf, and the people of Burgdorf, a small German town in the time of the Nazi Holocaust. The novel is set in World War I and continues through World War II. The Second World War is brought on by the hunger of power it is known as the otherness war. 'In the Third Reich otherness is a crime.';(Chadwick 2) Hitler, a Nazi leader, wants to gain control of Germany and surrounding countries. Hitler is a feared name even in our society today. We see things through the narrator's eyes. The novel has many flat characters in it. However, some characters are more developed than others are. Each character has a connection to the narrator whether he/she is a friend, a neighbor, or a bully at school. This novel is unique to Hegi because of her background. She lives in a 'suburb of 'Dusseldorf'; before she immigrates to the United States in 1965'; (Simon 1). It was unusual for her to write about this because the people who survive the holocaust never will talk about the past, they all believe in the 'tight lip' philosophy. In the novel Jews, Catholics, and Protestants become victims of the Nazis. Religious prejudices are common throughout the novel. However, Hegi portrays Catholicism as the primary faith. The author scatters many fairy tales and stories inscripted about the different types of religion throughout the text. 'Catholic water rusted Jewish cars.';(Hegi 88) However, the priest says, 'Protestant babies [are] pagan babies…and the Jewish babies [are] like Protestant babies,'; because they are not christened. (Hegi 58) In both the Jewish and Catholic religion different beliefs and celebrations bring commeraderie to the inhabitants of Burgdorf. While the Jews believe that Jesus is an exemplary man, but not God incarnate, the Catholics believe that Jesus lived and has died for our sins at the hands of the Romans. Catholics celebrate the Christ's Last Supper by receiving communion, a major sacrament in Catholicism because; communion in the Catholic Church is believed to be the body and blood of Jesus. It is believed that when one receives communion that all of one's sins will be wiped away. During the month of December the Jewish celebrate Hanukkah, while the Catholics celebrate St. Nikolaus and Christ's birth in Christmas. We celebrate his ... ...fferent than the rest provided a peaked interest to Max. He cares for her uniqueness not because she is different. Couples in today's society are always trying to change people and make them someone they are not. If one thinks they are going to change a person's personality and actions. Then they need to step back and take a good look at them maybe they are the ones who need to change. Stones From the River, is a wonderful novel. Hegi takes us through the World Wars and explains to us the affects they have on our society. Trudi in the novel takes in and helps shelter those who are hiding from the law. She believes that god put her here to help others and she does, with her gift of storytelling. If we all took the time to help one another than we should all get along. Jews, blacks, gays, and cripples are looked down upon. We are programmed to see people's flaws and to discriminate against those who have these differences. Many colleges have a diversification program that it sends all students through, but this is not solving our ignorance of race or gender. If we as a society become well educated on the horrific affects of our actions we could all live as one race, the human race.

Proteins Essay example -- science

Proteins Proteins are the macromolecules of life. Discovered in 1838, proteins are recognized as a large number of superior organic compounds that make up living organisms and are essential to their functioning. The term protein comes from the Greek word â€Å"proteies† or â€Å"primary†. Proteins have many different properties and function in a variety of ways. They can function as a building material, in teeth, bones and muscles, and they can serve as enzymes, hormones, and neurotransmitters. Its functions are the most diverse of any family. Whether found in humans, animals, plants or in single-celled bacteria, proteins are made of units of 20 different amino acids. Proteins consist of macromolecules called polypeptides, made from monomers called amino acids. Proteins have hundreds, thousands, or sometimes even millions of these amino acids. These amino acids are made up of carbon, hydrogen, oxygen, nitrogen, and sometimes sulfur. Some proteins consist of only single polypeptides. In most cases it involves two or more combined polypeptides, sometimes with other small organic molecules or metal ions. The most basic level of protein structure, called the primary structure, is the linear sequence of amino acids. Different sequences of the acids along a chain, however, affect the structure of a protein molecule in different ways. Protein’s secondary structure often contains long stretched out chains of amino acids called strands that line up together to make sheets. These are called beta strands and the sheets are called beta-pleated sheets. A protein may contain either or both alpha helices and beta pleated sheets. Alpha helices and beta pleated sheets are joined by less clear structures often grouped together under the name of coil. Some small proteins may be made of coil. Shape is also important. Proteins are coiled and twisted, giving it a unique shape. The shape depends on the sequence of the amino acids, which can be hydrophilic or hydrophobic. Those that are hydrophilic want contact with water and will be twisted to maximize contact. Those that are hydrophobic are twisted in such a way to minimize contact. Changing one amino acid in the polypeptide sequence can destroy this shape and make the protein function improperly if not at all. A very important function that proteins can serve are to act as catalysts. Enzymes are organic catalysts ma... ... cells their shape and as well as parts of the linkages that stick cells together into tissues and organs. So, the sequence of amino acids in all proteins is genetically determined by the sequence of nucleotides in cellular DNA. So basically Proteins are basic constituents in all living organisms. They are complex molecules composed of amino acid and necessary for the chemical processes that occur in living organisms. Proteins are sometimes referred to as macromolecular polypeptides because they are very large molecules and because the amino acids of which they are composed are joined by peptide bonds. The vast majority of the proteins found in living organisms are composed of only 20 different kinds of amino acids, repeated many times and strung together in a particular order. Each type of protein has its own unique sequence of amino acids. Also each protein makes every living organism different. Bibliography: 1. Proteins, Lexicon Universal Encyclopedia, 1989 Volume 15, pg.576. 2. www.biotech.imcb.edu.com 3. http://www.faseb.org/protein.html 4. â€Å"Proteins†. SceinceDaily.à ¾2000 à ¾www.sceincedaily.com 5. â€Å"Proteins†. Britannica Online 2000 à ¾www.britanncia.com

Analysis of Priceline

Priceline Inc. is an online travel booking site that helps customers worldwide purchase airfare, hotels, rental cars, and much more. The three categories I chose to analyze are business model and strategies, business finances, and expansion of the company through acquisitions. For Priceline to have success, I believe the business model and how the company builds its model is extremely important. Next, it is crucial that we look at the finances of the company to ensure it is profitable. The finances of the company are tied to the various acquisitions Priceline has acquired in the past few years. By looking at the companies Priceline has acquired, I strongly recommend investing in Priceline based off of the record earnings posted by the company. Not only is Priceline profitable, the corporation also has an unique business strategy to make money. When assigned this paper, I began to use databases and Factiva to search for information about Priceline. I used the information found from da tabases and used them as research to support my report. I then researched Priceline’s marketing techniques as well as stock prices in order to elaborate on the company’s finances. Finally, I learned about the companies Priceline has acquired over the years to expand its market presence. To figure out the formatting and structure of this paper, I used other people’s reports as guidance.IntroductionPriceline’s business model includes value proposition of connecting vendors and customers. It consists of a revenue model where there are transaction fees and spread earned by the company between vendor and customer price. Launched in 1998, Priceline Inc. does not directly supply travel services, but rather they bring buyers and sellers together to complete a transaction. Priceline saves consumers money by trading travel flexibility of brands and product features for sellers’ lower prices. Business Model and StrategiesEver since the development of the inte rnet, dot-com companies have been booming left and right. One of those companies founded during the dot-com boom was Priceline Inc., an online travel booking site that revolutionized the way consumers purchased air tickets, hotel rooms, rental cars, and much more. Priceline Inc. developed and innovated a new system of â€Å"Name your own  price† for customers to finalize their travels. They were able to turn excess inventory otherwise not sold by the airlines to consumers while at the same time price discriminate in order to maximize profits. In the airline industry, it is estimated that only 65% of the seats on a plane are occupied on a daily basis.Airlines definitely were looking a way to vend the rest of the inventory. However, they could not advertise these excess seats with special discount because in doing so, it would destroy its retail fare structure. Priceline was the solution to this as they are able to help shield airlines branding in two different ways. First, w hen consumers try to name your own price on Priceline, they must choose travels between two cities. In this case, the airlines’ branding and product configurations are protected as customers have no idea which airline they will be selecting. Only after a bid is accepted will they learn their exact flight information and itinerary. Secondly, Priceline protects those who are considered free riders. These are people who would receive the benefit of a discount but they are already willing to pay for an air ticket at a higher price (Eisenmann 47-48). Name Your Price GuaranteeFigure 1.1Source: (Priceline.com) Revenue Generation: Priceline is able to effectively generate revenue one of two ways. First, it calculates a spread between the lowest prices offered by the Airline partner and the highest prices a customer is willing to pay. In this scenario, neither party the airline partner nor the customer have the option of knowing the asking price or the bid price. A customer has no ide a what unpublished rate the airline is offering. Only Priceline would have this secret information. On the other hand, the airline does not get to see how much the consumers bid on the air ticket. For example, if a customer bids $300 on a ticket from LAX to JFK and the lowest unpublished rate for any given airline is $200, then the spread would be $100, which Priceline retains as its earnings. As seen from this model, profiting from the spread is highly successful given the economies of scale from customers (Eisenmann 47-48). Adaptive Marketing and Cross Subsidy:Furthermore, Priceline also offers consumers to bump up their bids by participating in â€Å"adaptive marketing† and â€Å"cross-subsidy† promotional programs. For instance, Priceline could add $50 to an existing $100 bid to make it more likely that a ticket will be sold if one signs up for a credit card. If that is the case, the credit card company may pay Priceline $75 for every referral that signs up for the card. In this case, Priceline would simply pocket the difference. If the asking price for the ticket was already under $100, then Priceline would keep all of the money coming from credit card sponsorship (Eisenmann 48).Business Finances Early Stages of Priceline: At the beginning of year 2000, Priceline had a market share of 3% of all airline tickets sold in the U.S. Attracting over 3.8 million unique visitors, Priceline sold tickets for all eight domestic airlines as well as 20 international carriers. One year after its establishment in 1998, Priceline’s revenue was $482 Million in 1999 and $1 Billion in 2000 (Eisenmann 48).However, the dot-com bubble would halt Priceline’s success only temporarily. 1999 was a tough year for Priceline as it stated a $1.1 Billion loss on its financial statement. Stock prices plunged from $974 to $7 a share. According to Walker, â€Å"there was a credibility issue† within the organization and investors did not completely trust t he dot-com industry. Priceline’s financials would improve slowly. In 2002, Priceline reported a net loss of $19 Million. When CEO Jeff Boyd took over the company in 2002, Priceline stocks had suffered one of the worst drops in its brief history. But soon enough, Priceline was able to make a turnaround when it introduced William Shatner as the negotiator character out of the blue to help consumers save money. Instantaneously, people remembered the advertisements put up by Priceline and associated with Shatner, a former Star-Trek star’s self-parody. William ShatnerFigure 1.2Source: (Thepenaltyflagblog.com) From Loss to Profit: Priceline started making a profit in 2003, but it wasn’t until 2004 and 2005 when Boyd bought two European hotel reservation sites—the U.K.'s Active Hotels and Amsterdam-based Booking.com that Priceline hit a turning point. â€Å"Priceline's earnings growth and stock market success since then have been attributable largely to those t wo acquisitions—Booking.com in particular. It would be tough to argue that there's been a better acquisition in Internet history,† says Thomas White, an analyst at Macquarie Securities. â€Å"It's why the stock has been such a home run,† says White.Thomas White and Barclays' DiClemente would agree that investors lack the knowledge that most of the revenue come from overseas. Since Europeans have many more vacation days as Americans, it is not surprising that more revenue is inflowing from Europe. Jeff Boyd, the CEO of Priceline, was smart about targeting such a market in Europe. â€Å"Moreover, the growth of discount airlines in Europe such as EasyJet and Ryanair have increased the popularity of â€Å"city breaks†Ã¢â‚¬â€the European equivalent of a weekend getaway,† states Birger. Earnings Report in 2012:In 2012, Priceline continued to post better than expected earnings reports. In the third quarter of 2012, Priceline reported third quarter revenue s of $1.71 Billion, up 17.4% from a year ago in 2011. Also, Priceline beat the estimate of $1.65 Billion projected revenue determined previously by analysts. Non-GAAP profits stood at $12.40 a share, ahead of the estimate of $11.81 a share. Gross bookings came in at $7.8 billion, elevated 25.2% from a year ago. For quarter four in 2012, Eric Savitz of Forbes magazine states â€Å"Priceline projected revenues to be up 21-28% or 22%-29% in local currency; revenues are expected to improve 15%-22%, with non-GAAP profits of $6.12 to $6.57 a share. Consensus has been for $6.34 a share.†Continuous Growth: In the mean time, CEO Jeff Boyd continues to have high hopes for Priceline. â€Å"Globally our hotel business grew room nights by 36% over the same period last year, compared to 39% growth in the second quarter,† he said. â€Å"Our rental car business grew rental car days by 35% over last year, an acceleration from 29% in the second quarter, led by improving results at Pric eline.com and continued strong growth from Rentalcars.com. While we remain concerned about economic weakness across Europe, Asia and the U.S., the [company] intends to focus on solidifying its position as the world's largest and most profitable online hotel reservation service by continuing to add hotels and other accommodations and better servicing our customers through constant innovation in our mobile and desktop sites.†As promised by Boyd, Priceline continued to show tremendous growth. On November 1st, 2012, Priceline stock was up $12.22 in regular session trading and jumped another $52 a share in after-hours trading to close at $638.95 (Savitz). Since then, Priceline sustains its momentum by reporting record earnings in the preceding quarters. Today, stock price for Priceline is even higher than few years ago. It currently trades at over $1,000 a share and constantly out competes against their rivals Expedia and Orbitz (Birger).10 Year Graph of Priceline (PCLN) Figure 1.3 Source: (Yahoo Finance) Acquisitions and Expansions Booking.com: Priceline is on track to make a very good move because it is believed that the online travel reservation market still has room for expansion in Europe. Priceline typically takes 15% of every transaction done on Booking.com; in return, the hotels have a much better chance to market and advertise to potential customers. After Priceline’s acquisition of Booking.com in July 2005 for $135 Million, its profits skyrocketed from $10 million in 2003 to $1.1 billion in 2011. No other acquisition has proven to be that successful in the 2000’s (O'Neill). Agoda and TraveljigSaw:In addition, Priceline is increasing its brand in Asia via its Agoda brand and it is growing its rental cars division as well, aided by a 2010 acquisition of global car-rental site TravelJigsaw. Ever since these acquisitions of smaller travel companies, Priceline is able to expand its market cap while its stock prices surged over 500% in the fo llowing five years (Birger). Kayak:In 2012, Priceline Inc. continues its acquisition practice with the purchase of Kayak for $1.8 Billion. Shareholders of Kayak received $40 per share. Kayak is successful in that it raised $91 Million in the July 2012 IPO through selling of 3.5 Million shares at $26 apiece. It has processed 302 million queries across its web. Kayak and Priceline are â€Å"two of the largest online-travel companies and it makes sense that these two companies would want to work together, of course, because they do have different strengths and different objectives,† said Dan Marcec, an analyst at Emarketer. With the acquisition of Kayak, Jeff Boyd states that â€Å"Priceline’s intention is for Kayak to be operated independently under the leadership of existing management, as with our other hands, with a primary focus on building value for its customers and advertising partners† (Levy).Conclusion Priceline Inc. operates as one of the biggest travel booking sites in the world. Its global presence in Europe and Asia as well in the Americas cannot be ignored. Priceline Inc. should be a company that is to be heavily invested in because of its revenue and profit posted by the corporation. Its record breaking earnings in the billions should easily attract the eyes of a savvy investor. Priceline will continue to post earnings through the way it does business by matching consumers with vendors and earning the difference in prices. With its continuous acquisitions of smaller booking sites, Priceline is set on par to be the dominant and primary go to website when it comes to travel bookings. Without a doubt, its stock prices will continue to soar as it expands its presence in Asia.

What Is the Effect of Lack of Sleep on College Students?

Running head: WHAT IS THE EFFECT OF LACK OF SLEEP ON A COLLEGE STUDENT'S BRAIN AND BEHAVIOR Gilbert and Weaver (2010) examined the sleep quality with academic performance with university students, whether it is complete sleep deprivation or poor sleep quality. This study was to determine if lack of sleep or having poor sleep value in non-demoralized college students were related to the low academic routine. The author’s expectations were to find the relationship between the student’s environment and lifestyle with their sleep patterns and the force it has on their educational performance.Within the study the authors found that being able to have good sleep patterns and quality is a big key part for student to have a good GPA and being able to pass all their academics. Yet, a huge portion of college students do not get plenty or a fair amount of sleep. The authors also found in their study that students should be more considerate on the sleep value and sleep amount they should have. To the authors awareness, This is the first study to have found a relationship between poor sleep quality and lower academic performance using a large sample size and importantly, for non depressed students alone. Gilbert and Weaver, 2010). This study will provide my research with the important factors of sleep and education for a college student, in order to foresee the academic routine on the student’s foundation of sleep quality and quantity. Also it would provide my study with the question of whether our society should start regulating students to sleep enough to perform better, or instead let the students perform as they are doing. The author could not prove that poor sleep patterns resulted in a lower GPA for students, they only knew the important contributions that pointed to the conclusions of the study.Another limitation was that when the author performed the study, they only performed the study on freshman college students and not any higher level colle ge students. Lastly, they didn't check the University transcripts for the student’s grade point average; they relied on the student’s honesty. Mateika, Millrood, and Mitru (2002) examined the consequences of sleep on learning performance and the behavior that results from lack of sleep, in adolescents. The authors did the study to see the different options to help students re-establish and balance their normal sleep and everyday routine.The expectations of authors were to find a solution to help young adults in preventing the cause of their lack of sleep, whether it was from their parents, the school, work, or medical reasons. From all the different perspective views of the authors, they found that, the side effects that manifest was a consequence of sleep deprivation are independent†¦include inattention and poor performance in the classroom and emotional and behavioral changes. (Mateika, et. al. , 2002). With that, they looked at different changes they could make , like changing the time of when school starts, or looking if the students had sleep disorder.They found that parents and school should help increase the promotion of healthy sleep patterns for the importance of the sleep on school and work performance and behavior in the student. This study provides a different perspective of how to deal with sleep deprivation, instead of looking at the students sleep patterns and lifestyle and changing that, this study looks at how parents, or schools can be change the lack of sleep in order for students to perform better in their school and work environment.This provides my study with the mentality that students are mostly not to blame for their own lack of sleep, the blame can be from the amount of workload the students get from their teachers, the time they go to school and leave, the time they go to work and leave work, or even the amount of time not being able to sleep due to stress or insomnia. So all this gives me different perspectives to look at in order to solve the problem of the cause of sleeplessness.The only limitation in this study is that when looking at school workload being increased and the early time of class becomes a bit of a problem with the amount of sleep the student loses and gains. Cruess and Wells (2006) examined the results of sleeplessness on the consumption of food and food choices, which may have a lead problem to health in issues to those who have, sleep deprivation, The authors did this study to show the link between sleep and food intake within college students.They believe that students who sleep less would choose them food that is less healthy, because the students are less concerned of their weight and more dependent on their mood and expediency. The authors expect to see more evidence showing that stress hormones are related with the relationship between sleeping and eating, which in other words, increases in stress lead to more snacking and a decrease in the consumption of typical meal -type foods (Oliver and Wardle, 1999).In their study they found that what they expected to find in the beginning had happened, in which there was a difference in food intake, measured by how much calories was consumed after the night of the students incomplete lack of sleep. The study also presented that there was a huge difference in food consumption and calorie intake on partial sleepless night and a normal night of rest.This study provides my research with the behavior of food with the student, how sleep deprivation can affect a student’s choice in food, which is chosen by the mood of the student, their health, the price, the convince, the familiarity and the students appeal towards the food, in which it all goes back to whether they had a normal nights rest, or sleepless night. There are many limitations to this study, the main limitations was that this study was based mostly on self-report information, which means that it may or may not be accurate information in the stu dy.Another important limitation was that some of the participants in the study had recorded the start of their food and sleep records in their journals on different days, which made it hard to frame the time of the study accurately. Moreno, Louzada, and Pereira (2010) examined the role of ecological aspects in sleep duration among adolescents who have less technology and adolescents who have advance technology and how it changes the relationship of their sleep patterns.The authors performed this study to bring out an opportunity to look at natural and ecological influences on different characteristics that is related to sleep behaviors; the authors wanted to understand why adolescents who have electric lights, and other high advance resources have a higher level of sleep deprivation, while those who have less technology have enough sleep and are able to perform better. Their expectation for the study was that there would be an interaction between the natural and ecological factors i n the sleep cycle of the adolescents.The study help the authors find that the occurrence of electric lighting in home of the adolescent is a critical factor that is related to the duration of the sleep, which results in regular amount of sleep to irregular amount of sleep in adolescents. These results are important in my study, because it supports the ideas that adolescents having advanced technology, is important when determining whether it is a factor in knowing it results in sleep deprivation. Kopasz et. al. 2008) examined that adolescent to not sleep enough and have different sleep patterns every day, due to adolescents decrease in sleep duration on school days and increase in the weekends. The purpose of this study for the authors was to find the relation between adolescents sleep schedule, the environments of the student and daytime tasks, and to look at the results with the sleep records the adolescents kept. The expectations of this study were to find a difference between th e sleep patterns of during the week and the weekends, and the difference between the ages of the students and how late or early they slept.The authors found what they were expecting, there was a significant difference between week and weekend nights, and the older students slept about an hour less per night compared with the youngest. (Kopasz, 2008). They found as our age increases, are sleep duration decreases. This study is important to my research, because it shows a new perspective of the topic, where it gives evidence of how our generation grows, we lose more sleep because of the changes in education, in life events, and our society.This study shows how teenager are suffering the consequences of having sleep deprivation due to having to work and go to school, on top of family issues and the workload teachers give students. This is important to my study because the authors foretell that sleep deprivations in found adults is a global problem with severe consequences. The inconsis tencies in the body of research are that there is not much research or experiments in the relationship of sleep and the brain with a college student.There is much said about students behaviors with there is lack of sleep in their daily routines, but to know what happens, or what goes on in the brain, when it suffers from sleep deprivation will give my study a better perspective of the bigger picture. The gap that are in the body of this literature review is important, because it gives my study resources to look at and explore in which the other studies did not. My study will do research in both the brain and the behavior in all levels of non-depressed college students who have sleep deprivation and figure out what is the main cause of the students lack of sleep in their college lifestyle.References Gilbert, S. P. , and Weaver, C. C. (2010). Sleep Quality and Academic Performance in University Students: A Wake Up Call For College Psychologists. Journal Of College Student Psychotherap y, 24(4), 295-306. doi: 1080/87568225. 2010. 509245. Mateika J. H. , Millrood, D. L. , and Mitru, G. (2002) The Impact Of Sleep On Learning And Behavior In Adolescents. Teachers College Records, 104(4), 704-726. doi: 10. 1111/1467-9620. 00176. Cruess, D. G. , and Wells, T. T. (2006). Effects of Partial Sleep Deprivation On Food Consumption And Food Choice. Psychology & Health, 21(1), 79-86. doi: 10. 1080/1476820500102301. Oliver, G. and Wardle, J. (1999). Perceived Effects Of Stress On Food Choice. Physiology and Behavior, 66, 511-515. Moreno, C. C. , Louzada, F. , and Pereira, E. (2010). Not All Adolescents Are Sleep Deprived: A Study Of Rural Populations. Sleep And Biological Rhythms, 8(4), 267-273. doi: 10. 1111/j. 1479-8425. 2010. 00458. x. Kopasz, M. M. , Loessi, B. B. , Riemann, D. D. , Valerius, G. G. , Voderholzer, U. U. (2008). Are Adolescents Chronically Sleep-Deprived? An Investigation Of Sleep habits Of Adolescents In The Southwest Of Germany. Child: Care, Health, And De velopment, 34(5), 549-556. doi: 10. 1111/j. 1365-2214. 2008. 00845. x.

Bio 201 Final Review

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? – The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. – TRUE ________can convert proto-oncogenes into oncogenes. – Nonsense mutations Most human embryos that are aneuploidy – are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. – FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? – 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. – BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? – mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called – maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â €“ are on the same chromosome. An episome is – a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. – FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. – an F factor What can be inferred from an organism that has undergone a gene knockout? – The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? – identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? – G1 Certain types of cancer are caused by viruses. – TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as – both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to – get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? – random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain – All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. – FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. – TRUE Which of the following does not contribute to the infectious ability of prions? – Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? – Plant cells are totipotent. Which of the following is an advantage of molecular pharming? – The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp – base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. – FALSE A gene created from the fusion of two gene fragments is considered a – chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. – FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. – 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? – F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that – two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. – FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is – codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance – can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â €“ competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. – TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? – xeroderma pigmentosum Cancers originate from a single cell. – TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? – two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? – centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? – 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? – Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. – TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because – All of the statements given are true. Quantitative traits – are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | – 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. – TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is – a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. – TRUE Which of the following is a possible use for gene cloning? – All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? – Every band matches. What is required for a group of clones to be considered a contig? – The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? – nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be – metastatic. The process by which haploid cells are produced from diploid cells is called – meiosis In a haploid dominant species – the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that – alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? – both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? – either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called – epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. – 3,2Drugs that are HIV protease inhibitors – prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. – TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â‚¬â€œ TRUE The entire collection of a species' proteins is known as its – proteome Which of the following pollutants could be reduced with the use of bioremediation? – All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. – TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? – a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. – FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) – oncogene The formation of the bivalent during meiosis – contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. – 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. – TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. – FALSE Which of the following statements correctly describes a quantitative trait? – People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. – a sex pilus, single strand of DNA Integrase – cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? – cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage – TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. – FALSE In mammals, males are ________ and females are ____________. – hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. – 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. – cytoplasm Place the following events of bacterial transformation in order from first to last. – DNA replication b â €“ an enzyme joins F factor DNA ends c – sex pilus shortens d – DNA transfer e – an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? – plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? – They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? – tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. – two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. – TRUE The sex of all animals is determined by chromosomes. – FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? – missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? – Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that – the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission – All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. – supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? – A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. – checkpoint proteins In mitosis, the main difference between plant and animal cells is that – plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? – the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? – Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? – direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce – a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? – 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in – an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant â€Å"rescue† could have been caused by â₠¬â€œ addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? – Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? – cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone – gene amplification. All of the following are chemical mutations EXCEPT – X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? – Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is – pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? – Triple X syndrome Prokaryotes – include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to – All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. – S Sexual life cycles include both haploid and diploid stages. – TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce â€Å"Labradoodles† is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow â€Å"Texas Beauty† rose with a true-breeding â€Å"Ruby† red rose, you get all red roses. But when you cross a â€Å"Texas Beauty† yellow with the yellow variety â€Å"Jealousy,† you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? – The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? – All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins – do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because – if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. – IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because – HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in – the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? – polymerase chain reaction (PCR) Polyploidy in plants – All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, – chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because – they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? – 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? – A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.